DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
Full item page Simple item page
- dc.contributor.author Aparicio i Prat, Estel, 1986-ca
- dc.contributor.author Arnan Ros, Carmeca
- dc.contributor.author Sala, Ilariaca
- dc.contributor.author Bosch Roca, Núriaca
- dc.contributor.author Guigó Serra, Rodericca
- dc.contributor.author Johnson, Roryca
- dc.date.accessioned 2015-11-20T10:03:54Z
- dc.date.available 2015-11-20T10:03:54Z
- dc.date.issued 2015ca
- dc.description Erratum note: Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below/n/n"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)"./n/nPlease also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCCen
- dc.description.abstract Background. CRISPR genome-editing technology makes it possible to quickly and cheaply delete non-protein-coding regulatory elements. We present a vector system adapted for this purpose called DECKO (Double Excision CRISPR Knockout), which applies a simple two-step cloning to generate lentiviral vectors expressing two guide RNAs (gRNAs) simultaneously. The key feature of DECKO is its use of a single 165 bp starting oligonucleotide carrying the variable sequences of both gRNAs, making it fully scalable from single-locus studies to complex library cloning./nResults. We apply DECKO to deleting the promoters of one protein-coding gene and two oncogenic lncRNAs, UCA1 and the highly-expressed MALAT1, focus of many previous studies employing RNA interference approaches. DECKO successfully deleted genomic fragments ranging in size from 100 to 3000 bp in four human cell lines. Using a clone-derivation workflow lasting approximately 20 days, we obtained 9 homozygous and 17 heterozygous promoter knockouts in three human cell lines. Frequent target region inversions were observed. These clones have reductions in steady-state MALAT1 RNA levels of up to 98 % and display reduced proliferation rates./nConclusions. We present a dual CRISPR tool, DECKO, which is cloned using a single starting oligonucleotide, thereby affording simplicity and scalability to CRISPR knockout studies of non-coding genomic elements, including long non-coding RNAs.
- dc.description.sponsorship We acknowledge support of the Spanish Ministry of Economy and Competitiveness, ‘Centro de Excelencia Severo Ochoa 2013-2017’, SEV-2012-0208. This work was financially supported by the following grants: CSD2007-00050 from the Spanish Ministry of Science, grant SGR-1430 from the Catalan Government, grant ERC-2011-AdG-294653-RNA-MAPS from the European Community financial support under the FP7 and grant R01MH101814 by the National Human Genome Research Institute of the National Institutes of Health, to RG. Ramón y Cajal RYC-2011-08851 and Plan Nacional BIO2011-27220 to RJ.
- dc.format.mimetype application/pdfca
- dc.identifier.citation Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigó R, Johnson R. DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015;16:846.ca
- dc.identifier.doi http://dx.doi.org/10.1186/s12864-015-2086-z
- dc.identifier.issn 1471-2164ca
- dc.identifier.uri http://hdl.handle.net/10230/25167
- dc.language.iso engca
- dc.publisher BioMed Centralca
- dc.relation.ispartof BMC Genomics. 2015;16:846
- dc.relation.projectID info:eu-repo/grantAgreement/EC/FP7/294653
- dc.relation.projectID info:eu-repo/grantAgreement/ES/2PN/CSD2007-00050
- dc.relation.projectID info:eu-repo/grantAgreement/ES/3PN/BIO2011-27220
- dc.relation.projectID info:eu-repo/grantAgreement/ES/3PN/RYC2011-08851
- dc.rights © 2015 Aparicio-Prat et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.ca
- dc.rights.accessRights info:eu-repo/semantics/openAccessca
- dc.rights.uri http://creativecommons.org/licenses/by/4.0/
- dc.subject.keyword CRISPR
- dc.subject.keyword Genome editing
- dc.subject.keyword DECKO
- dc.subject.keyword Long non-coding RNA
- dc.subject.keyword lncRNA
- dc.subject.other Genoma humà
- dc.title DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAsca
- dc.type info:eu-repo/semantics/articleca
- dc.type.version info:eu-repo/semantics/publishedVersionca