DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs
Citació
- Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigó R, Johnson R. DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015;16:846.
Enllaç permanent
Descripció
Resum
Background. CRISPR genome-editing technology makes it possible to quickly and cheaply delete non-protein-coding regulatory elements. We present a vector system adapted for this purpose called DECKO (Double Excision CRISPR Knockout), which applies a simple two-step cloning to generate lentiviral vectors expressing two guide RNAs (gRNAs) simultaneously. The key feature of DECKO is its use of a single 165 bp starting oligonucleotide carrying the variable sequences of both gRNAs, making it fully scalable from single-locus studies to complex library cloning./nResults. We apply DECKO to deleting the promoters of one protein-coding gene and two oncogenic lncRNAs, UCA1 and the highly-expressed MALAT1, focus of many previous studies employing RNA interference approaches. DECKO successfully deleted genomic fragments ranging in size from 100 to 3000 bp in four human cell lines. Using a clone-derivation workflow lasting approximately 20 days, we obtained 9 homozygous and 17 heterozygous promoter knockouts in three human cell lines. Frequent target region inversions were observed. These clones have reductions in steady-state MALAT1 RNA levels of up to 98 % and display reduced proliferation rates./nConclusions. We present a dual CRISPR tool, DECKO, which is cloned using a single starting oligonucleotide, thereby affording simplicity and scalability to CRISPR knockout studies of non-coding genomic elements, including long non-coding RNAs.Descripció
Erratum note: Unfortunately, the original version of this article [1] contained an error. In the Methods part, in the Design and Cloning of Plasmids section, a sentence was included incorrectly. The correct sentence can be found below/n/n"The Insert-2 sequence was previously assembled from four 5'-phosphorilated oligonucleotides (IDT)"./n/nPlease also note in table S3 The oligo pDECKO_seq_R is lacking one nucleotide. The correct sequence is ATGTCTACTATTCTTTCCCC